modernduck.com
the unofficial website of Jody McIntyre
Archive for July, 2009
Feline DNA sequence
Jul 26th
This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project.
Update: Found!
tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga
Yeah, it looks like any other DNA sequence from any other animal… but I’ll know 
I’m in your city killing your dudes
Jul 24th
We’ve all seen ads on the web that change depending on where they think you are: “Hot Montreal girls that want to fuck you now” or even “Hot Stittsville girls.” I’ve never even been to Stittsville. Maybe I should go – apparently the girls are just as attractive as the girls here, and probably more desperate.
I’m somehow less convinced by this ad though:
Boulder + BM
Jul 22nd
Boulder for work (and hopefully climbing):
Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44
Sun Jul 26, 21:55: UA 933, IAD-DEN, arr 23:41
Mon Aug 3, 11:05: AC 1072, DEN-YUL, arr 16:37
Burning man!!!
Tue Aug 25, 9:45: AC 761, YUL-SFO, arr 12:52
Wed Sep 9, 13:15: AC 587, SFO-YYC, arr 16:49
Wed Sep 9, 17:50: AC 186, YYC-YUL, arr 23:47