Archive for July, 2009

Feline DNA sequence

4

This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project.

Update: Found!

tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga

Yeah, it looks like any other DNA sequence from any other animal… but I’ll know :)

I’m in your city killing your dudes

3

We’ve all seen ads on the web that change depending on where they think you are: “Hot Montreal girls that want to fuck you now” or even “Hot Stittsville girls.” I’ve never even been to Stittsville. Maybe I should go – apparently the girls are just as attractive as the girls here, and probably more desperate.

I’m somehow less convinced by this ad though:

Boulder + BM

2

Boulder for work (and hopefully climbing):

Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44
Sun Jul 26, 21:55: UA  933, IAD-DEN, arr 23:41
Mon Aug  3, 11:05: AC 1072, DEN-YUL, arr 16:37

Burning man!!!

Tue Aug 25,  9:45: AC 761, YUL-SFO, arr 12:52
Wed Sep  9, 13:15: AC 587, SFO-YYC, arr 16:49
Wed Sep  9, 17:50: AC 186, YYC-YUL, arr 23:47

Go to Top