This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project.

Update: Found!

tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga

Yeah, it looks like any other DNA sequence from any other animal… but I’ll know :)