Comments on: Feline DNA sequence http://modernduck.com/2009/07/feline-dna-sequence/ the unofficial website of Jody McIntyre Sat, 12 May 2012 20:30:14 +0000 hourly 1 http://wordpress.org/?v=3.3 By: scjody http://modernduck.com/2009/07/feline-dna-sequence/comment-page-1/#comment-558 scjody Mon, 27 Jul 2009 22:04:41 +0000 http://modernduck.com/2009/07/feline-dna-sequence/#comment-558 <p><u>Gödel, Escher, Bach: Douglas Hofstadter is Smarter Than You</u> makes that claim. Not willing to download the whole genome to verify this though :)</p> Gödel, Escher, Bach: Douglas Hofstadter is Smarter Than You makes that claim. Not willing to download the whole genome to verify this though :)

]]> By: swestrup http://modernduck.com/2009/07/feline-dna-sequence/comment-page-1/#comment-557 swestrup Mon, 27 Jul 2009 08:44:32 +0000 http://modernduck.com/2009/07/feline-dna-sequence/#comment-557 <p>I seem to recall that the domestic cat actually has about 1000 base pairs that just spell</p> <p>catcatcatcatcatcatcatcat...</p> <p>I'm not sure if that's unique to felines though.</p> I seem to recall that the domestic cat actually has about 1000 base pairs that just spell

catcatcatcatcatcatcatcat…

I’m not sure if that’s unique to felines though.

]]> By: scjody http://modernduck.com/2009/07/feline-dna-sequence/comment-page-1/#comment-556 scjody Mon, 27 Jul 2009 03:36:13 +0000 http://modernduck.com/2009/07/feline-dna-sequence/#comment-556 <p>A friend sent me a link to a database online. Thanks though!</p> A friend sent me a link to a database online. Thanks though!

]]> By: grimmwire http://modernduck.com/2009/07/feline-dna-sequence/comment-page-1/#comment-555 grimmwire Mon, 27 Jul 2009 02:25:55 +0000 http://modernduck.com/2009/07/feline-dna-sequence/#comment-555 <p>I've passed your query on to a friend who runs a genome database at McGill; his area is insects, but he might know where to look.</p> I’ve passed your query on to a friend who runs a genome database at McGill; his area is insects, but he might know where to look.

]]>