Skip to content

modernduck.com

the unofficial website of Jody McIntyre

Menu
  • Meow and welcome! 😺
  • Blog
  • Subscribe by email
Menu

Feline DNA sequence

Posted on July 26, 2009May 8, 2013 by scjody

This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project.

Update: Found!

tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga

Yeah, it looks like any other DNA sequence from any other animal… but I’ll know :)

4 thoughts on “Feline DNA sequence”

  1. grimmwire says:
    July 26, 2009 at 21:25

    I’ve passed your query on to a friend who runs a genome database at McGill; his area is insects, but he might know where to look.

    1. scjody says:
      July 26, 2009 at 22:36

      A friend sent me a link to a database online. Thanks though!

  2. swestrup says:
    July 27, 2009 at 03:44

    I seem to recall that the domestic cat actually has about 1000 base pairs that just spell

    catcatcatcatcatcatcatcat…

    I’m not sure if that’s unique to felines though.

    1. scjody says:
      July 27, 2009 at 17:04

      Gödel, Escher, Bach: Douglas Hofstadter is Smarter Than You makes that claim. Not willing to download the whole genome to verify this though :)

Comments are closed.

Recent Posts

  • drop the chant book
  • Bohême Système 2025
  • Accueil
  • An interesting LLM test case
  • Greetings!
  • Sondage OsstidBurn 2018
  • gcloud compute ssh improvements & EMACS TRAMP mode
  • Flat Pack Kitchen Shelves & Wash Station
  • This is not a place of honor.
  • LOOK AT THIS DUCK

Subscribe by email


Archives

  • October 2025 (1)
  • September 2025 (1)
  • November 2024 (1)
  • July 2024 (1)
  • November 2023 (1)
  • November 2018 (1)
  • February 2018 (1)
  • November 2017 (1)
  • August 2016 (1)
  • October 2013 (1)
  • May 2013 (1)
  • February 2013 (1)
  • November 2012 (1)
  • May 2012 (1)
  • April 2012 (2)
  • March 2012 (1)
  • February 2012 (1)
  • January 2012 (1)
  • December 2011 (1)
  • November 2011 (1)
  • October 2011 (1)
  • September 2011 (1)
  • August 2011 (1)
  • July 2011 (1)
  • June 2011 (1)
  • May 2011 (1)
  • March 2011 (2)
  • February 2011 (1)
  • January 2011 (4)
  • December 2010 (1)
  • November 2010 (1)
  • October 2010 (1)
  • September 2010 (3)
  • August 2010 (4)
  • July 2010 (15)
  • June 2010 (16)
  • May 2010 (17)
  • April 2010 (10)
  • March 2010 (10)
  • February 2010 (19)
  • January 2010 (10)
  • November 2009 (6)
  • October 2009 (1)
  • September 2009 (1)
  • July 2009 (2)
  • June 2009 (3)
  • May 2009 (2)
  • April 2009 (6)
  • March 2009 (5)
  • February 2009 (3)
  • January 2009 (4)
  • December 2008 (5)
  • November 2008 (1)
  • October 2008 (5)
  • September 2008 (4)
  • August 2008 (2)
  • July 2008 (4)
  • June 2008 (2)
  • May 2008 (2)
  • April 2008 (5)
  • March 2008 (4)
  • February 2008 (2)
  • January 2008 (1)
  • December 2007 (3)
  • November 2007 (5)
  • October 2007 (3)
  • September 2007 (5)
  • August 2007 (2)
  • July 2007 (2)
  • June 2007 (2)
  • May 2007 (1)
  • April 2007 (4)
  • March 2007 (4)
  • February 2007 (1)
  • December 2006 (2)
  • November 2006 (4)
  • October 2006 (3)
  • September 2006 (3)
  • August 2006 (3)
  • July 2006 (1)
  • May 2006 (1)
  • March 2006 (1)
  • November 2005 (2)
  • October 2005 (1)
  • August 2005 (4)
  • June 2005 (1)
  • May 2005 (3)
  • February 2005 (3)
  • January 2005 (1)
  • October 2004 (1)
  • September 2004 (3)
  • August 2004 (2)
  • June 2004 (1)
  • May 2004 (6)
  • March 2004 (1)
  • February 2004 (1)
  • January 2004 (1)
  • November 2003 (1)
  • October 2003 (1)
  • September 2003 (1)
  • August 2003 (1)
  • July 2003 (1)
  • June 2003 (3)
  • May 2003 (2)
© 2025 modernduck.com | Powered by Minimalist Blog WordPress Theme