This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project.
Update: Found!
tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga
Yeah, it looks like any other DNA sequence from any other animal… but I’ll know :)
I’ve passed your query on to a friend who runs a genome database at McGill; his area is insects, but he might know where to look.
A friend sent me a link to a database online. Thanks though!
I seem to recall that the domestic cat actually has about 1000 base pairs that just spell
catcatcatcatcatcatcatcat…
I’m not sure if that’s unique to felines though.
Gödel, Escher, Bach: Douglas Hofstadter is Smarter Than You makes that claim. Not willing to download the whole genome to verify this though :)