Skip to content

modernduck.com

the unofficial website of Jody McIntyre

Menu
  • Meow and welcome! 😺
  • Blog
  • Subscribe by email
Menu

Category: Uncategorized

Feline DNA sequence

Posted on July 26, 2009May 8, 2013 by scjody

This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project. Update: Found! tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga Yeah, it looks like any other DNA sequence from any other…

Continue reading

Boulder + BM

Posted on July 22, 2009May 8, 2013 by scjody

Boulder for work (and hopefully climbing): Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44 Sun Jul 26, 21:55: UA 933, IAD-DEN, arr 23:41 Mon Aug 3, 11:05: AC 1072, DEN-YUL, arr 16:37 Burning man!!! Tue Aug 25, 9:45: AC 761, YUL-SFO, arr 12:52 Wed Sep 9, 13:15: AC 587, SFO-YYC, arr 16:49 Wed Sep…

Continue reading

Fringe list

Posted on June 13, 2009May 8, 2013 by scjody

My Fringe List: shows I definitely want to see, plus shows I’ve seen that you definitely need to see. May be updated throughout the week, or not.

Continue reading
Posted on June 12, 2009May 8, 2013 by scjody

"Anyway," Dave said. "I had a better idea.""Different idea," said Morley.  "You had a different idea."

Continue reading
Posted on June 10, 2009May 8, 2013 by scjody

Buttersafe is so much win.

Continue reading

Last Minute Birthday Dinner

Posted on May 27, 2009May 8, 2013 by scjody

My birthday snuck up on me this year but I still want to do something. If you’re free on Friday, come out for dinner! If not, no worries, I’ll have a proper house party sometime this summer :) PLEASE RSVP BY THURSDAY EVENING so I can reserve – here or on FB Note: the restaurant…

Continue reading

Don’t go to Burning Man.

Posted on May 8, 2009May 8, 2013 by scjody

It’s an addiction. Next chance to get my fix: PDF. Fri May 22, 17:49: US 3409, YUL-PHL, arr 19:35 Mon May 25, 20:45: US 3906, PHL-YUL, arr 22:23 For some reason, I thought Monday was a holiday in Canada as well but it’s the Monday before. So I’m just going to drive to PHL fairly…

Continue reading
Posted on April 26, 2009May 8, 2013 by scjody

Wed Apr 29, 16:45: AC 8981, YUL-YOW, arr 17:24 Wed Apr 29, 18:40: AC 888, YOW-LHR, arr 6:25 Apr 30 Thu Apr 30, 8:50: BD 82, LHR-BHD, arr 10:10 Friday: Grandma‘s funeral. Died suddenly on Caturday. Sun May 3, 8:50: BD 83, BHD-LHR, arr 10:15 Sun May 3, 15:30: AC 865, LHR-YUL, arr 17:50

Continue reading

Cody Rivers tonight?

Posted on April 23, 2009May 8, 2013 by scjody

I’m going to see Cody Rivers tonight at 20:00 at Mainline. They were at Fringe last year but this is a completely new show. Also, they’re not at Fringe this year, so this is your chance. Also playing Fri, Cat at 20:00… but I’m going tonight. Let me know if you want to join.

Continue reading
Posted on April 20, 2009May 8, 2013 by scjody

In the east there is a shark which is larger than all other fish. It changes into a bird whose wings are like clouds filling the sky. When this bird moves across the land, it brings a message from Corporate Headquarters. This message it drops into the midst of the programmers, like a seagull making…

Continue reading

The return of Ceiling Cat

Posted on April 12, 2009May 8, 2013 by scjody

Ceiling Cat finally made it to Montréal from California on Caturday, December 20. I got up on Sunday the 21st and needed something to do as a distraction from the rest of my life. Then I spotted Him, still packed flat and wrapped up in an old bedsheet. There was to be a Solstice celebration…

Continue reading

Protected: Sun/IBM

Posted on April 3, 2009May 8, 2013 by scjody

There is no excerpt because this is a protected post.

Continue reading

Toronto itinerary

Posted on April 1, 2009May 8, 2013 by scjody

Fri Apr 17, 15:40: Via 65, Montréal-Toronto, arr 20:24 Sun Apr 19, 17:00: Via 66, Toronto-Montréal, arr 21:33 As I mentioned here before, I’m doing the CN Tower Climb, and you can still sponsor me if you like.

Continue reading

Party next weekend!

Posted on March 21, 2009May 8, 2013 by scjody

obskura is turning 11111 next Caturday, which is a good reason for a party :) It’s at my house on Caturday, March 28th. Let me know if you need the address or directions. 17:00-20:00: family friendly time, since a lot of you have kids now. Show up hungry if you like – we’ll have plenty…

Continue reading

apple++

Posted on March 19, 2009May 8, 2013 by scjody

Today, I got an Airport Express because I wanted to play music from my computer on the speakers in my bedroom (without dragging the computer in every time.) The complete setup process: Took it out of the box, plugged it in. Found the "Airport Setup Utility" already installed on my MacBook and ran it. It disconnected…

Continue reading

I think I’m a Montréaler now…

Posted on March 19, 2009May 8, 2013 by scjody

Last Caturday, walking back to obskura‘s after a party: <scjody> I’m kinda hungry. Is there any good food around here that isn’t Dad’s? <obskura> There’s a pizza place up ahead. <scjody> That sounds good. Is it the kind of place where I can get une pointe? Um, uh, I mean a slice. Couldn’t remember the…

Continue reading

Advance warning: Robin’s birthday

Posted on March 6, 2009May 8, 2013 by scjody

Robin and I are having a party on her birthday: March 28. If you read this, you’re probably invited. Details and a proper invitation to follow :)

Continue reading

CN tower climb

Posted on March 2, 2009May 8, 2013 by scjody

I’m doing the CN tower stair climb this April 18… Let me know if you’re interested in joining in. Infos here, and you can sponsor me by donating to the World Wrestling Federation if that’s your kind of thing. (Tax receipts for donations of $20 or more.)

Continue reading

morning bright rise

Posted on February 14, 2009May 8, 2013 by scjody

“Morning.” “Good morning.” “Have you seen the coffee filters?” “Corner cupboard.” “Did you see what Zoe did to the toilet roll?” “Yeah, that dog can be bad.” “Morning.” “You’ve worked in a restaurant before?” “Yeah, I figured I should warm up the coffee cups.” “Nice.” “Hey, man.” “Hey.” “Coffee?” “Did you see the toilet roll?”…

Continue reading

Protected: Fun in Boulder

Posted on February 13, 2009May 8, 2013 by scjody

There is no excerpt because this is a protected post.

Continue reading
  • Previous
  • 1
  • …
  • 4
  • 5
  • 6
  • 7
  • 8
  • 9
  • 10
  • …
  • 14
  • Next

Recent Posts

  • drop the chant book
  • Bohême Système 2025
  • Accueil
  • An interesting LLM test case
  • Greetings!
  • Sondage OsstidBurn 2018
  • gcloud compute ssh improvements & EMACS TRAMP mode
  • Flat Pack Kitchen Shelves & Wash Station
  • This is not a place of honor.
  • LOOK AT THIS DUCK

Subscribe by email


Archives

  • October 2025 (1)
  • September 2025 (1)
  • November 2024 (1)
  • July 2024 (1)
  • November 2023 (1)
  • November 2018 (1)
  • February 2018 (1)
  • November 2017 (1)
  • August 2016 (1)
  • October 2013 (1)
  • May 2013 (1)
  • February 2013 (1)
  • November 2012 (1)
  • May 2012 (1)
  • April 2012 (2)
  • March 2012 (1)
  • February 2012 (1)
  • January 2012 (1)
  • December 2011 (1)
  • November 2011 (1)
  • October 2011 (1)
  • September 2011 (1)
  • August 2011 (1)
  • July 2011 (1)
  • June 2011 (1)
  • May 2011 (1)
  • March 2011 (2)
  • February 2011 (1)
  • January 2011 (4)
  • December 2010 (1)
  • November 2010 (1)
  • October 2010 (1)
  • September 2010 (3)
  • August 2010 (4)
  • July 2010 (15)
  • June 2010 (16)
  • May 2010 (17)
  • April 2010 (10)
  • March 2010 (10)
  • February 2010 (19)
  • January 2010 (10)
  • November 2009 (6)
  • October 2009 (1)
  • September 2009 (1)
  • July 2009 (2)
  • June 2009 (3)
  • May 2009 (2)
  • April 2009 (6)
  • March 2009 (5)
  • February 2009 (3)
  • January 2009 (4)
  • December 2008 (5)
  • November 2008 (1)
  • October 2008 (5)
  • September 2008 (4)
  • August 2008 (2)
  • July 2008 (4)
  • June 2008 (2)
  • May 2008 (2)
  • April 2008 (5)
  • March 2008 (4)
  • February 2008 (2)
  • January 2008 (1)
  • December 2007 (3)
  • November 2007 (5)
  • October 2007 (3)
  • September 2007 (5)
  • August 2007 (2)
  • July 2007 (2)
  • June 2007 (2)
  • May 2007 (1)
  • April 2007 (4)
  • March 2007 (4)
  • February 2007 (1)
  • December 2006 (2)
  • November 2006 (4)
  • October 2006 (3)
  • September 2006 (3)
  • August 2006 (3)
  • July 2006 (1)
  • May 2006 (1)
  • March 2006 (1)
  • November 2005 (2)
  • October 2005 (1)
  • August 2005 (4)
  • June 2005 (1)
  • May 2005 (3)
  • February 2005 (3)
  • January 2005 (1)
  • October 2004 (1)
  • September 2004 (3)
  • August 2004 (2)
  • June 2004 (1)
  • May 2004 (6)
  • March 2004 (1)
  • February 2004 (1)
  • January 2004 (1)
  • November 2003 (1)
  • October 2003 (1)
  • September 2003 (1)
  • August 2003 (1)
  • July 2003 (1)
  • June 2003 (3)
  • May 2003 (2)
© 2025 modernduck.com | Powered by Minimalist Blog WordPress Theme