This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project. Update: Found! tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga Yeah, it looks like any other DNA sequence from any other…
Category: Uncategorized
Boulder + BM
Boulder for work (and hopefully climbing): Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44 Sun Jul 26, 21:55: UA 933, IAD-DEN, arr 23:41 Mon Aug 3, 11:05: AC 1072, DEN-YUL, arr 16:37 Burning man!!! Tue Aug 25, 9:45: AC 761, YUL-SFO, arr 12:52 Wed Sep 9, 13:15: AC 587, SFO-YYC, arr 16:49 Wed Sep…
Fringe list
My Fringe List: shows I definitely want to see, plus shows I’ve seen that you definitely need to see. May be updated throughout the week, or not.
"Anyway," Dave said. "I had a better idea.""Different idea," said Morley. "You had a different idea."
Buttersafe is so much win.
Last Minute Birthday Dinner
My birthday snuck up on me this year but I still want to do something. If you’re free on Friday, come out for dinner! If not, no worries, I’ll have a proper house party sometime this summer :) PLEASE RSVP BY THURSDAY EVENING so I can reserve – here or on FB Note: the restaurant…
Don’t go to Burning Man.
It’s an addiction. Next chance to get my fix: PDF. Fri May 22, 17:49: US 3409, YUL-PHL, arr 19:35 Mon May 25, 20:45: US 3906, PHL-YUL, arr 22:23 For some reason, I thought Monday was a holiday in Canada as well but it’s the Monday before. So I’m just going to drive to PHL fairly…
Wed Apr 29, 16:45: AC 8981, YUL-YOW, arr 17:24 Wed Apr 29, 18:40: AC 888, YOW-LHR, arr 6:25 Apr 30 Thu Apr 30, 8:50: BD 82, LHR-BHD, arr 10:10 Friday: Grandma‘s funeral. Died suddenly on Caturday. Sun May 3, 8:50: BD 83, BHD-LHR, arr 10:15 Sun May 3, 15:30: AC 865, LHR-YUL, arr 17:50
Cody Rivers tonight?
I’m going to see Cody Rivers tonight at 20:00 at Mainline. They were at Fringe last year but this is a completely new show. Also, they’re not at Fringe this year, so this is your chance. Also playing Fri, Cat at 20:00… but I’m going tonight. Let me know if you want to join.
In the east there is a shark which is larger than all other fish. It changes into a bird whose wings are like clouds filling the sky. When this bird moves across the land, it brings a message from Corporate Headquarters. This message it drops into the midst of the programmers, like a seagull making…
The return of Ceiling Cat
Ceiling Cat finally made it to Montréal from California on Caturday, December 20. I got up on Sunday the 21st and needed something to do as a distraction from the rest of my life. Then I spotted Him, still packed flat and wrapped up in an old bedsheet. There was to be a Solstice celebration…
Protected: Sun/IBM
There is no excerpt because this is a protected post.
Toronto itinerary
Fri Apr 17, 15:40: Via 65, Montréal-Toronto, arr 20:24 Sun Apr 19, 17:00: Via 66, Toronto-Montréal, arr 21:33 As I mentioned here before, I’m doing the CN Tower Climb, and you can still sponsor me if you like.
Party next weekend!
obskura is turning 11111 next Caturday, which is a good reason for a party :) It’s at my house on Caturday, March 28th. Let me know if you need the address or directions. 17:00-20:00: family friendly time, since a lot of you have kids now. Show up hungry if you like – we’ll have plenty…
apple++
Today, I got an Airport Express because I wanted to play music from my computer on the speakers in my bedroom (without dragging the computer in every time.) The complete setup process: Took it out of the box, plugged it in. Found the "Airport Setup Utility" already installed on my MacBook and ran it. It disconnected…
I think I’m a Montréaler now…
Last Caturday, walking back to obskura‘s after a party: <scjody> I’m kinda hungry. Is there any good food around here that isn’t Dad’s? <obskura> There’s a pizza place up ahead. <scjody> That sounds good. Is it the kind of place where I can get une pointe? Um, uh, I mean a slice. Couldn’t remember the…
Advance warning: Robin’s birthday
Robin and I are having a party on her birthday: March 28. If you read this, you’re probably invited. Details and a proper invitation to follow :)
CN tower climb
I’m doing the CN tower stair climb this April 18… Let me know if you’re interested in joining in. Infos here, and you can sponsor me by donating to the World Wrestling Federation if that’s your kind of thing. (Tax receipts for donations of $20 or more.)
morning bright rise
“Morning.” “Good morning.” “Have you seen the coffee filters?” “Corner cupboard.” “Did you see what Zoe did to the toilet roll?” “Yeah, that dog can be bad.” “Morning.” “You’ve worked in a restaurant before?” “Yeah, I figured I should warm up the coffee cups.” “Nice.” “Hey, man.” “Hey.” “Coffee?” “Did you see the toilet roll?”…
Protected: Fun in Boulder
There is no excerpt because this is a protected post.