A few notes on my travel blogging: I’m not going to be putting photos in my blog entries for the next while. It just takes too much time in front of a computer, and entries get posted a lot later as a result too. You can see my latest photos on flickr (and I’ll try…
Category: Uncategorized
Hikoning in Hakone
Robin wanted to try some onsen and see Mount Fuji, so we headed to Tokyo’s famous Hakone mountain resort area to do just that. It’s also an interesting region from a transit point of view. JR only serves the nearby city of Odawara, so from there you need to use the private Odakyu railway. From…
Can has Cat Mountain?
Onwards from Sakurajima: I took the train from Kagoshima to Kumamoto and spent the evening in town. Historically, that’s an interesting combination because of Saigo Takamori. He was an important figure in the Meiji Restoration, during which Japan restored contact with the rest of the world and consolidated government power under the emperor as a…
Active volcano!
The next morning it was raining and I was hung over, so I borrowed an umbrella, bought some coffee from the vending machine, and went back to bed for a few hours. After that, I went to the train station and rented a bike. JR have managed to make renting bikes more complicated than renting…
Beware the Orange Lanterns
On my last night in Kagoshima, I decided to try imo-jochu, a local specialty. I walked out of the place I was staying and went about half a block to the first orange lantern. Orange lanterns can mean many things in Japan but usually they mean an izakaya, which is a traditional Japanese pub. There…
Kaimon
I climbed Kaimon Dake. It was a far more strenuous climb than Kibune and Kurama, but worth it for the views and the simple joy of climbing. There is a small shrine at the top of the mountain. I think the spirit enshrined there is an alcoholic. Instead of the usual coin box, there were…
Ibusuki
There’s only one reason for most people to go to Ibusuki: the sandbath – the only natural one in the world. There’s a section of sand along the beach that’s heated by volcanic steam. You can get buried in the hot sand and lie there for as long as you like. It feels about how…
Yamayaki at Nara
I found out that there was a fire festival on Saturday in Nara – an ancient capital of Japan close to Kyoto and Osaka. I decided to go to Nara for the day, then head to Osaka at night as originally planned. Nara is strange. According to local legend, the god Sento rode to Nara…
Kyoto!
I just arrived in Kyoto. I took the Nozomi – the fastest kind of shinkansen – which took just over 2 hours from Shinagawa station. I’ll be here for at least the next 4 days… My last few days in Tokyo were interesting. It was nice to be able to explore the city a bit…
Today I…
Today I accidentally: Bought a notebook for $35. Not a special notebook – last time I bought something similar, it was $6 at Staples. Took a subway line I’d never heard of, that wasn’t even on my map. Found Shibuya’s Love Hotel Hill. Finally saw HachikÅ the dog. Today I quite intentionally: Looked at cheap…
Trip planning continues…
Booked: Fri Feb 26, 17:50: UA 875, NRT-SIN, arr 0:20 Feb 27 (with Robin) I’ve also summarized a lot of my ideas so far on their own page. And yes I’ll be blogging on my website, which also shows up as a note on Facebook.
Featuring Loretta
If you see only one Suburban Motel play, make it Featuring Loretta. Hilarious. The others are worth seeing too, but that one is a must. Caturday 21 Nov 2009 – 14:00 & 19:00 Funday 22 Nov 2009 – 14:00 & 19:00 Mainline Theatre
Plays tonight?
Anyone want to go see Featuring Loretta & The End of Civilization tonight at Mainline Theatre? These are plays 3 and 4 of the Suburban Motel series, but each is a standalone play so don’t worry if you missed the first two.
Today’s dose of WIN
click for more For some reason, these remind me of Wallace and Gromit.
Go see Bent.
Those of you in Montréal who like plays MUST go see Altera Vitae’s production of Bent. Awesome. Also, welcome to my new blog. WordPress + Dreamhost = significantly less suck than before.
…and so it begins.
The difference between dreams and plans is when you book a ticket :) I’m traveling in Asia next year! Air travel booked so far: Thu Dec 24, 20:50: AC 632, YUL-YYT, arr 0:47 Dec 25. With Robin and Aslan. Wed Dec 30, 7:00: AC 1197, YYT-YYZ, arr 9:15. Robin’s heading back to Montréal around the…
Camera gear for sale
I’m selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn’t sell is going on eBay where I can get slightly more than the prices I’ve listed, so these are NOT negotiable.
Teen Sleuth is back!
If you missed it at fringe, or (like me) saw it at fringe and need to see it again, Teen Sleuth and the Freed Cyborg Choir is playing Wednesday -> Funday at MainLine Theatre. I’m going on either Wednesday, Caturday, or Funday. Let me know if you want to join in!
Feline DNA sequence
This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project. Update: Found! tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga Yeah, it looks like any other DNA sequence from any other…
Boulder + BM
Boulder for work (and hopefully climbing): Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44 Sun Jul 26, 21:55: UA 933, IAD-DEN, arr 23:41 Mon Aug 3, 11:05: AC 1072, DEN-YUL, arr 16:37 Burning man!!! Tue Aug 25, 9:45: AC 761, YUL-SFO, arr 12:52 Wed Sep 9, 13:15: AC 587, SFO-YYC, arr 16:49 Wed Sep…