If you see only one Suburban Motel play, make it Featuring Loretta. Hilarious. The others are worth seeing too, but that one is a must. Caturday 21 Nov 2009 – 14:00 & 19:00 Funday 22 Nov 2009 – 14:00 & 19:00 Mainline Theatre
Blog
Plays tonight?
Anyone want to go see Featuring Loretta & The End of Civilization tonight at Mainline Theatre? These are plays 3 and 4 of the Suburban Motel series, but each is a standalone play so don’t worry if you missed the first two.
Today’s dose of WIN
click for more For some reason, these remind me of Wallace and Gromit.
Go see Bent.
Those of you in Montréal who like plays MUST go see Altera Vitae’s production of Bent. Awesome. Also, welcome to my new blog. WordPress + Dreamhost = significantly less suck than before.
…and so it begins.
The difference between dreams and plans is when you book a ticket :) I’m traveling in Asia next year! Air travel booked so far: Thu Dec 24, 20:50: AC 632, YUL-YYT, arr 0:47 Dec 25. With Robin and Aslan. Wed Dec 30, 7:00: AC 1197, YYT-YYZ, arr 9:15. Robin’s heading back to Montréal around the…
Camera gear for sale
I’m selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn’t sell is going on eBay where I can get slightly more than the prices I’ve listed, so these are NOT negotiable.
Teen Sleuth is back!
If you missed it at fringe, or (like me) saw it at fringe and need to see it again, Teen Sleuth and the Freed Cyborg Choir is playing Wednesday -> Funday at MainLine Theatre. I’m going on either Wednesday, Caturday, or Funday. Let me know if you want to join in!
Feline DNA sequence
This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project. Update: Found! tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga Yeah, it looks like any other DNA sequence from any other…
Boulder + BM
Boulder for work (and hopefully climbing): Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44 Sun Jul 26, 21:55: UA 933, IAD-DEN, arr 23:41 Mon Aug 3, 11:05: AC 1072, DEN-YUL, arr 16:37 Burning man!!! Tue Aug 25, 9:45: AC 761, YUL-SFO, arr 12:52 Wed Sep 9, 13:15: AC 587, SFO-YYC, arr 16:49 Wed Sep…
Fringe list
My Fringe List: shows I definitely want to see, plus shows I’ve seen that you definitely need to see. May be updated throughout the week, or not.
"Anyway," Dave said. "I had a better idea.""Different idea," said Morley. "You had a different idea."
Buttersafe is so much win.
Last Minute Birthday Dinner
My birthday snuck up on me this year but I still want to do something. If you’re free on Friday, come out for dinner! If not, no worries, I’ll have a proper house party sometime this summer :) PLEASE RSVP BY THURSDAY EVENING so I can reserve – here or on FB Note: the restaurant…
Don’t go to Burning Man.
It’s an addiction. Next chance to get my fix: PDF. Fri May 22, 17:49: US 3409, YUL-PHL, arr 19:35 Mon May 25, 20:45: US 3906, PHL-YUL, arr 22:23 For some reason, I thought Monday was a holiday in Canada as well but it’s the Monday before. So I’m just going to drive to PHL fairly…
Wed Apr 29, 16:45: AC 8981, YUL-YOW, arr 17:24 Wed Apr 29, 18:40: AC 888, YOW-LHR, arr 6:25 Apr 30 Thu Apr 30, 8:50: BD 82, LHR-BHD, arr 10:10 Friday: Grandma‘s funeral. Died suddenly on Caturday. Sun May 3, 8:50: BD 83, BHD-LHR, arr 10:15 Sun May 3, 15:30: AC 865, LHR-YUL, arr 17:50
Cody Rivers tonight?
I’m going to see Cody Rivers tonight at 20:00 at Mainline. They were at Fringe last year but this is a completely new show. Also, they’re not at Fringe this year, so this is your chance. Also playing Fri, Cat at 20:00… but I’m going tonight. Let me know if you want to join.
In the east there is a shark which is larger than all other fish. It changes into a bird whose wings are like clouds filling the sky. When this bird moves across the land, it brings a message from Corporate Headquarters. This message it drops into the midst of the programmers, like a seagull making…
The return of Ceiling Cat
Ceiling Cat finally made it to Montréal from California on Caturday, December 20. I got up on Sunday the 21st and needed something to do as a distraction from the rest of my life. Then I spotted Him, still packed flat and wrapped up in an old bedsheet. There was to be a Solstice celebration…
Protected: Sun/IBM
There is no excerpt because this is a protected post.
Toronto itinerary
Fri Apr 17, 15:40: Via 65, Montréal-Toronto, arr 20:24 Sun Apr 19, 17:00: Via 66, Toronto-Montréal, arr 21:33 As I mentioned here before, I’m doing the CN Tower Climb, and you can still sponsor me if you like.