Skip to content

modernduck.com

the unofficial website of Jody McIntyre

Menu
  • Meow and welcome! 😺
  • Blog
  • Subscribe by email
Menu

Category: Uncategorized

Emergency sleeping in Japan

Posted on February 26, 2010May 8, 2013 by scjody

Robin and I are crazy but not insane – our love hotel adventure wasn’t actually all that risky. We fortunately didn’t have to use any of these, but there are many emergency sleeping options in the nightlife areas of large Japanese cities: Capsule hotels. Usually for men only, although some women-only or mixed places are…

Continue reading

Blogging notes

Posted on February 22, 2010May 8, 2013 by scjody

A few notes on my travel blogging: I’m not going to be putting photos in my blog entries for the next while. It just takes too much time in front of a computer, and entries get posted a lot later as a result too. You can see my latest photos on flickr (and I’ll try…

Continue reading

Hikoning in Hakone

Posted on February 22, 2010May 8, 2013 by scjody

Robin wanted to try some onsen and see Mount Fuji, so we headed to Tokyo’s famous Hakone mountain resort area to do just that. It’s also an interesting region from a transit point of view. JR only serves the nearby city of Odawara, so from there you need to use the private Odakyu railway. From…

Continue reading

Can has Cat Mountain?

Posted on February 6, 2010May 8, 2013 by scjody

Onwards from Sakurajima: I took the train from Kagoshima to Kumamoto and spent the evening in town. Historically, that’s an interesting combination because of Saigo Takamori. He was an important figure in the Meiji Restoration, during which Japan restored contact with the rest of the world and consolidated government power under the emperor as a…

Continue reading

Active volcano!

Posted on February 6, 2010May 8, 2013 by scjody

The next morning it was raining and I was hung over, so I borrowed an umbrella, bought some coffee from the vending machine, and went back to bed for a few hours. After that, I went to the train station and rented a bike. JR have managed to make renting bikes more complicated than renting…

Continue reading

Beware the Orange Lanterns

Posted on February 5, 2010May 8, 2013 by scjody

On my last night in Kagoshima, I decided to try imo-jochu, a local specialty. I walked out of the place I was staying and went about half a block to the first orange lantern. Orange lanterns can mean many things in Japan but usually they mean an izakaya, which is a traditional Japanese pub. There…

Continue reading

Kaimon

Posted on February 5, 2010May 8, 2013 by scjody

I climbed Kaimon Dake. It was a far more strenuous climb than Kibune and Kurama, but worth it for the views and the simple joy of climbing. There is a small shrine at the top of the mountain. I think the spirit enshrined there is an alcoholic. Instead of the usual coin box, there were…

Continue reading

Ibusuki

Posted on February 5, 2010March 17, 2021 by scjody

There’s only one reason for most people to go to Ibusuki: the sandbath – the only natural one in the world. There’s a section of sand along the beach that’s heated by volcanic steam. You can get buried in the hot sand and lie there for as long as you like. It feels about how…

Continue reading

Yamayaki at Nara

Posted on February 2, 2010May 8, 2013 by scjody

I found out that there was a fire festival on Saturday in Nara – an ancient capital of Japan close to Kyoto and Osaka. I decided to go to Nara for the day, then head to Osaka at night as originally planned. Nara is strange. According to local legend, the god Sento rode to Nara…

Continue reading

Kyoto!

Posted on January 19, 2010May 8, 2013 by scjody

I just arrived in Kyoto.  I took the Nozomi – the fastest kind of shinkansen – which took just over 2 hours from Shinagawa station.  I’ll be here for at least the next 4 days… My last few days in Tokyo were interesting.  It was nice to be able to explore the city a bit…

Continue reading

Today I…

Posted on January 3, 2010May 8, 2013 by scjody

Today I accidentally: Bought a notebook for $35.  Not a special notebook – last time I bought something similar, it was $6 at Staples. Took a subway line I’d never heard of, that wasn’t even on my map. Found Shibuya’s Love Hotel Hill. Finally saw Hachikō the dog. Today I quite intentionally: Looked at cheap…

Continue reading

Trip planning continues…

Posted on November 24, 2009May 8, 2013 by scjody

Booked: Fri Feb 26, 17:50: UA 875, NRT-SIN, arr 0:20 Feb 27 (with Robin) I’ve also summarized a lot of my ideas so far on their own page.  And yes I’ll be blogging on my website, which also shows up as a note on Facebook.

Continue reading

Featuring Loretta

Posted on November 21, 2009March 17, 2021 by scjody

If you see only one Suburban Motel play, make it Featuring Loretta. Hilarious. The others are worth seeing too, but that one is a must. Caturday 21 Nov 2009 – 14:00 & 19:00 Funday 22 Nov 2009 – 14:00 & 19:00 Mainline Theatre

Continue reading

Plays tonight?

Posted on November 20, 2009May 8, 2013 by scjody

Anyone want to go see Featuring Loretta & The End of Civilization tonight at Mainline Theatre? These are plays 3 and 4 of the Suburban Motel series, but each is a standalone play so don’t worry if you missed the first two.

Continue reading

Today’s dose of WIN

Posted on November 9, 2009May 8, 2013 by scjody

click for more For some reason, these remind me of Wallace and Gromit.

Continue reading

Go see Bent.

Posted on November 7, 2009May 8, 2013 by scjody

Those of you in Montréal who like plays MUST go see Altera Vitae’s production of Bent.  Awesome. Also, welcome to my new blog.  WordPress + Dreamhost = significantly less suck than before.

Continue reading

…and so it begins.

Posted on November 2, 2009May 8, 2013 by scjody

The difference between dreams and plans is when you book a ticket :) I’m traveling in Asia next year! Air travel booked so far: Thu Dec 24, 20:50: AC 632, YUL-YYT, arr 0:47 Dec 25. With Robin and Aslan. Wed Dec 30, 7:00: AC 1197, YYT-YYZ, arr 9:15. Robin’s heading back to Montréal around the…

Continue reading

Camera gear for sale

Posted on October 22, 2009May 8, 2013 by scjody

I’m selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn’t sell is going on eBay where I can get slightly more than the prices I’ve listed, so these are NOT negotiable.

Continue reading

Teen Sleuth is back!

Posted on September 29, 2009May 8, 2013 by scjody

If you missed it at fringe, or (like me) saw it at fringe and need to see it again, Teen Sleuth and the Freed Cyborg Choir is playing Wednesday -> Funday at MainLine Theatre. I’m going on either Wednesday, Caturday, or Funday. Let me know if you want to join in!

Continue reading

Feline DNA sequence

Posted on July 26, 2009May 8, 2013 by scjody

This is a long shot, but does anyone know where I can get a DNA sequence from a cat – any cat? I don’t even need the whole thing – 100 base pairs should be enough. It’s for an art project. Update: Found! tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga Yeah, it looks like any other DNA sequence from any other…

Continue reading
  • Previous
  • 1
  • …
  • 3
  • 4
  • 5
  • 6
  • 7
  • 8
  • 9
  • …
  • 14
  • Next

Recent Posts

  • Bohême Système 2025
  • Accueil
  • An interesting LLM test case
  • Greetings!
  • Sondage OsstidBurn 2018
  • gcloud compute ssh improvements & EMACS TRAMP mode
  • Flat Pack Kitchen Shelves & Wash Station
  • This is not a place of honor.
  • LOOK AT THIS DUCK
  • Just leaving this here…

Subscribe by email


Archives

  • September 2025 (1)
  • November 2024 (1)
  • July 2024 (1)
  • November 2023 (1)
  • November 2018 (1)
  • February 2018 (1)
  • November 2017 (1)
  • August 2016 (1)
  • October 2013 (1)
  • May 2013 (1)
  • February 2013 (1)
  • November 2012 (1)
  • May 2012 (1)
  • April 2012 (2)
  • March 2012 (1)
  • February 2012 (1)
  • January 2012 (1)
  • December 2011 (1)
  • November 2011 (1)
  • October 2011 (1)
  • September 2011 (1)
  • August 2011 (1)
  • July 2011 (1)
  • June 2011 (1)
  • May 2011 (1)
  • March 2011 (2)
  • February 2011 (1)
  • January 2011 (4)
  • December 2010 (1)
  • November 2010 (1)
  • October 2010 (1)
  • September 2010 (3)
  • August 2010 (4)
  • July 2010 (15)
  • June 2010 (16)
  • May 2010 (17)
  • April 2010 (10)
  • March 2010 (10)
  • February 2010 (19)
  • January 2010 (10)
  • November 2009 (6)
  • October 2009 (1)
  • September 2009 (1)
  • July 2009 (2)
  • June 2009 (3)
  • May 2009 (2)
  • April 2009 (6)
  • March 2009 (5)
  • February 2009 (3)
  • January 2009 (4)
  • December 2008 (5)
  • November 2008 (1)
  • October 2008 (5)
  • September 2008 (4)
  • August 2008 (2)
  • July 2008 (4)
  • June 2008 (2)
  • May 2008 (2)
  • April 2008 (5)
  • March 2008 (4)
  • February 2008 (2)
  • January 2008 (1)
  • December 2007 (3)
  • November 2007 (5)
  • October 2007 (3)
  • September 2007 (5)
  • August 2007 (2)
  • July 2007 (2)
  • June 2007 (2)
  • May 2007 (1)
  • April 2007 (4)
  • March 2007 (4)
  • February 2007 (1)
  • December 2006 (2)
  • November 2006 (4)
  • October 2006 (3)
  • September 2006 (3)
  • August 2006 (3)
  • July 2006 (1)
  • May 2006 (1)
  • March 2006 (1)
  • November 2005 (2)
  • October 2005 (1)
  • August 2005 (4)
  • June 2005 (1)
  • May 2005 (3)
  • February 2005 (3)
  • January 2005 (1)
  • October 2004 (1)
  • September 2004 (3)
  • August 2004 (2)
  • June 2004 (1)
  • May 2004 (6)
  • March 2004 (1)
  • February 2004 (1)
  • January 2004 (1)
  • November 2003 (1)
  • October 2003 (1)
  • September 2003 (1)
  • August 2003 (1)
  • July 2003 (1)
  • June 2003 (3)
  • May 2003 (2)
© 2025 modernduck.com | Powered by Minimalist Blog WordPress Theme